POLDIP3

Ensembl ID:
ENSDARG00000091032
Description:
polymerase (DNA-directed), delta interacting protein 3 [Source:HGNC Symbol;Acc:23782]
Human Orthologue:
POLDIP3
Human Description:
polymerase (DNA-directed), delta interacting protein 3 [Source:HGNC Symbol;Acc:23782]
Mouse Orthologue:
Poldip3
Mouse Description:
polymerase (DNA-directed), delta interacting protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39969 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121600 Nonsense 13 362 1 5
Genomic Location (Zv9):
Chromosome 3 (position 1982147)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1440359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCCCCGCCCATATGAAAGTGAAACGCATGCGCGTTGATGTGCGCAGA[G/T]AACCAGCAGGCGCAGATATGGCGGACTTGTCTCTGGATGAAGTGATTCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link