si:ch211-153a8.4

Ensembl ID:
ENSDARG00000091031
ZFIN ID:
ZDB-GENE-030131-6830
Human Orthologue:
HAUS8
Human Description:
HAUS augmin-like complex, subunit 8 [Source:HGNC Symbol;Acc:30532]
Mouse Orthologue:
Haus8
Mouse Description:
4HAUS augmin-like complex, subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1923728]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30736 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125163 Nonsense 208 357 7 10
ENSDART00000135785   None 243 None 8
ENSDART00000143752 Nonsense 208 267 7 8
Genomic Location (Zv9):
Chromosome 23 (position 12568608)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12527410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAACACACAGAAGTAAACCCCAAGAAGCGTCAGTATCTGCTGCTG[C/T]AAAAGCAGAAAGAGCTCAACAGTTTACTGGACTTACAGGTCATTTTCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link