si:ch211-218h8.1

Ensembl ID:
ENSDARG00000091026
ZFIN ID:
ZDB-GENE-081103-16

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26328 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126906 Essential Splice Site 659 965 3 7
ENSDART00000131216   None 769 None 6
Genomic Location (Zv9):
Chromosome 4 (position 34049982)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 39845282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGACACTGAG[G/A]TCTGAGCTAGGGCAACTCATTGATTGATTTGTTTTTATATTACATTAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link