LOC799983

Ensembl ID:
ENSDARG00000091020
Human Orthologue:
FAM83A
Human Description:
family with sequence similarity 83, member A [Source:HGNC Symbol;Acc:28210]
Mouse Orthologue:
Fam83a
Mouse Description:
family with sequence similarity 83, member A Gene [Source:MGI Symbol;Acc:MGI:2447773]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15710 Essential Splice Site Available for shipment Available now
sa36243 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128448 Essential Splice Site 170 426 1 4
Genomic Location (Zv9):
Chromosome 16 (position 47589943)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44788139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCCTCCATGAAAGACRTGCTGCGGGAGCTCATCAGGCAAGCAACAAAA[G/A]TAAGAACCTTAAATTTCATGGAGCCTTTTTAAGACATTATTACTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128448 Nonsense 346 426 4 4
Genomic Location (Zv9):
Chromosome 16 (position 47575891)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44774087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGTGCCCAACAGGACTTGCTGGAAACACTGCTGACCACACACAACAG[A/T]AATCTTGTAAGCCCAGAACCCAGAGTTTCCCAACACCACCTGTCCTGGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link