ENSDARG00000091009

Ensembl ID:
ENSDARG00000091009

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22129 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6260 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Essential Splice Site 171 363 5 6
Genomic Location:
Chromosome 12 (position 32231095)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTCATTCGCTCTCAAGTTCCTGTCACTAAGAAACTCTTCCAAAGTT[G/A]TAAGGATCTTTACATTTTCCCATAACACTTGCTCTTTTTTTTAACACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Essential Splice Site 172 363 5 6
Genomic Location:
Chromosome 12 (position 32231096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCATTCGCTCTCAAGTTCCTGTCACTAAGAAACTCTTCCAAAGTTG[T/A]AAGGATCTTYACATTTTCCCATAACACTTGCTCNNTTTTTTAACACCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h3pcn5x4