ENSDARG00000091009

Ensembl ID:
ENSDARG00000091009

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27979 Nonsense Mutation detected in F1 DNA During 2016
sa31884 Nonsense Available for shipment Available now
sa22129 Essential Splice Site Available for shipment Available now
sa6260 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Nonsense 19 363 2 6
Genomic Location (Zv9):
Chromosome 12 (position 32228064)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30449041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTATCATATTCAAGGACACTCCAACAAAACATGAGGAGGACCTGAGG[A/T]GACAAAGAGACATTTTGGCTTTCCGAATGAAGAAGCTGTCATCAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Nonsense 33 363 2 6
Genomic Location (Zv9):
Chromosome 12 (position 32228107)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30449084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGGAGACAAAGAGACATTTTGGCTTTCCGAATGAAGAAGCTGTCAT[C/A]AAAACAATCCGATTTCAATGTAAGTCAGTGAAACAAGCATTAACATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Essential Splice Site 171 363 5 6
Genomic Location (Zv9):
Chromosome 12 (position 32231095)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30452072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTCATTCGCTCTCAAGTTCCTGTCACTAAGAAACTCTTCCAAAGTT[G/A]TAAGGATCTTTACATTTTCCCATAACACTTGCTCTTTTTTTTAACACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126064 Essential Splice Site 172 363 5 6
Genomic Location (Zv9):
Chromosome 12 (position 32231096)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 30452073
KASP Assay ID:
554-4171.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTCATTCGCTCTCAAGTTCCTGTCACTAAGAAACTCTTCCAAAGTTG[T/A]AAGGATCTTYACATTTTCCCATAACACTTGCTCNNTTTTTTAACACCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link