FNDC7 (7 of 7)

Ensembl ID:
ENSDARG00000091008
Description:
fibronectin type III domain containing 7 [Source:HGNC Symbol;Acc:26668]
Human Orthologue:
FNDC7
Human Description:
fibronectin type III domain containing 7 [Source:HGNC Symbol;Acc:26668]
Mouse Orthologue:
Fndc7
Mouse Description:
fibronectin type III domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2443535]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37592 Nonsense Mutation detected in F1 DNA During 2017
sa43904 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123698 Nonsense 26 239 1 3
Genomic Location (Zv9):
Chromosome 23 (position 1681394)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1649579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGAGTGCAGTGCTGCGCTGGAGCAGATATGATGGTGCGCTGTCCTA[C/A]AGAGTTACAGCTTCTCTACGCAACTCTCCAGTGCCTCTGGTCTTTGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123698 Essential Splice Site 85 239 1 3
Genomic Location (Zv9):
Chromosome 23 (position 1681215)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1649400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATAGCCTCATGAACGGACTGGCAGACGCTAATGTGGATGGATCTACAG[G/A]TGCGTATATTAAAAACTGACGATACCATACACTGTACAAATAGCTGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link