si:ch211-207g17.1

Ensembl ID:
ENSDARG00000091006
ZFIN ID:
ZDB-GENE-100922-152
Human Orthologue:
COBL
Human Description:
cordon-bleu homolog (mouse) [Source:HGNC Symbol;Acc:22199]
Mouse Orthologue:
Cobl
Mouse Description:
cordon-bleu Gene [Source:MGI Symbol;Acc:MGI:105056]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36044 Nonsense Mutation detected in F1 DNA During 2017
sa22756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123710 Nonsense 68 708 1 4
ENSDART00000136939   None 335 None 4
Genomic Location (Zv9):
Chromosome 16 (position 9840963)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8626902
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAAGCATCTCTAGCCAACCGTGCACACCGTGTGGAGTTATCCAAAAC[A/T]AAAACAACAATGCCTGTCTAACAGAGGAGAAACACAGAAGCCCATTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123710 Nonsense 690 708 4 4
ENSDART00000136939 Nonsense 317 335 4 4
Genomic Location (Zv9):
Chromosome 16 (position 9832750)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 8618689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACTTGATGCTTTTATTTACACAGGTCCCTGTCACACAGACAAGAAGG[C/T]AAGTGAACGGGAGACTTGGCACCATTCAAGCAACATCACCCCTCTCTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: Genome-wide association study and meta-analysis find that over 40 loci affect risk of type 1 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link