PARM1

Ensembl ID:
ENSDARG00000090996
Description:
prostate androgen-regulated mucin-like protein 1 [Source:HGNC Symbol;Acc:24536]
Human Orthologue:
PARM1
Human Description:
prostate androgen-regulated mucin-like protein 1 [Source:HGNC Symbol;Acc:24536]
Mouse Orthologue:
Parm1
Mouse Description:
prostate androgen-regulated mucin-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443349]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21686 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128967 Nonsense 65 319 2 4
Genomic Location (Zv9):
Chromosome 10 (position 15094175)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15107482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTACAGGTTCTCCAGTAACCGTAACATCAGGTGGTGCCACTGAGGAA[C/T]AAAAAACAACTGCTTCTCCAACAATTTTGACCAATACAAGTGAAACAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link