LOC100334939

Ensembl ID:
ENSDARG00000090988
Human Orthologue:
LARS
Human Description:
leucyl-tRNA synthetase [Source:HGNC Symbol;Acc:6512]
Mouse Orthologue:
Lars
Mouse Description:
leucyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1913808]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40048 Nonsense Mutation detected in F1 DNA During 2017
sa38382 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129540 Nonsense 120 357 5 10
Genomic Location (Zv9):
Chromosome 3 (position 21205255)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20964992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGCTGAAGAGAGAAATGGAGCTGTATGGTTATCCGCCCCAATTCCCT[G/T]AAGAAGATGAAGAGGAGGAAGAGCAGAAGAAGACCTCTGATGACGTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129540 Nonsense 226 357 7 10
Genomic Location (Zv9):
Chromosome 3 (position 21202227)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 20961964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTAAACCCCTTTTACGACTCTTTTGTGAGGTGGCAGTTCATCAATT[T/A]GAAAGAGAGAAAGAAGATCAAGTTTGGGAAAAGGTATGGTAAAAATATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link