NP_001177394.1

Ensembl ID:
ENSDARG00000090977
Description:
interferon-induced protein with tetratricopeptide repeats 5-like [Source:RefSeq peptide;Acc:NP_0011
Human Orthologues:
IFIT1, IFIT1B, IFIT2, IFIT3, IFIT5
Human Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 [Source:HGNC Symbol;Acc:5407]
interferon-induced protein with tetratricopeptide repeats 1B [Source:HGNC Symbol;Acc:23442]
interferon-induced protein with tetratricopeptide repeats 2 [Source:HGNC Symbol;Acc:5409]
interferon-induced protein with tetratricopeptide repeats 3 [Source:HGNC Symbol;Acc:5411]
interferon-induced protein with tetratricopeptide repeats 5 [Source:HGNC Symbol;Acc:13328]
Mouse Orthologues:
2010002M12Rik, Gm14446, I830012O16Rik, Ifit1, Ifit2, Ifit3
Mouse Descriptions:
interferon-induced protein with tetratricopeptide repeats 1 Gene [Source:MGI Symbol;Acc:MGI:99450]
interferon-induced protein with tetratricopeptide repeats 2 Gene [Source:MGI Symbol;Acc:MGI:99449]
interferon-induced protein with tetratricopeptide repeats 3 Gene [Source:MGI Symbol;Acc:MGI:1101055]
predicted gene 14446 Gene [Source:MGI Symbol;Acc:MGI:3650685]
RIKEN cDNA 2010002M12 gene Gene [Source:MGI Symbol;Acc:MGI:2148249]
RIKEN cDNA I830012O16 gene Gene [Source:MGI Symbol;Acc:MGI:3698419]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15526 Nonsense Available for shipment Available now
sa22070 Nonsense Available for shipment Available now
sa22069 Nonsense Available for shipment Available now
sa42002 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125902 Nonsense 134 446 2 3
Genomic Location (Zv9):
Chromosome 12 (position 18057111)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16868285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATAAACTACCACATGGAGAAMTACACAGAGTGCGAAAGTTACCTGGTT[A/T]AGCTTCAGAAGATAMATGAAAGATTTGCAAYTGAGTCTTCAGCTGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125902 Nonsense 216 446 2 3
Genomic Location (Zv9):
Chromosome 12 (position 18056865)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16868039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGAATTTTAACCCACCACCTTGTACTGTGGAAACACCTGCAATAAAA[C/T]AGCTGAGACAGGCCATTGACTTAAACCCAGATGATGATGTTCTGAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125902 Nonsense 237 446 2 3
Genomic Location (Zv9):
Chromosome 12 (position 18056802)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16867976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGACTTAAACCCAGATGATGATGTTCTGAGAGTTATTCTAGGAATT[A/T]AACTTTTGAATTGCTCCAAAGGTTTAATGAACGAGTCCGAGCAATTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125902 Essential Splice Site 438 446 2 3
Genomic Location (Zv9):
Chromosome 12 (position 18056196)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16867370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAATAGAAGTGCACAGAAACTGTGCAACATTGCCAAGAAAAATCTCAAG[T/C]TAAATCCAAATGATTGGAAAGCCAATGAAATACTGGGCTTAGTTTATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link