si:dkey-114e9.1

Ensembl ID:
ENSDARG00000090974
ZFIN ID:
ZDB-GENE-100922-20
Human Orthologue:
EPHA3
Human Description:
EPH receptor A3 [Source:HGNC Symbol;Acc:3387]
Mouse Orthologue:
Epha3
Mouse Description:
Eph receptor A3 Gene [Source:MGI Symbol;Acc:MGI:99612]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15750 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122016 Nonsense 162 297 3 3
ENSDART00000135136 Nonsense 162 269 3 3
Genomic Location (Zv9):
Chromosome 9 (position 16185818)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16456695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGATGAGAGCTTTACTCAGATGGACCTAGGTGACCGCATTCTGARGT[T/A]AAACACAGAGGTCCGTGAGGTGGGGCCCATGACTAAGAAGGGCTTCTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link