LOC561649

Ensembl ID:
ENSDARG00000090973
Human Orthologue:
CCDC50
Human Description:
coiled-coil domain containing 50 [Source:HGNC Symbol;Acc:18111]
Mouse Orthologue:
Ccdc50
Mouse Description:
coiled-coil domain containing 50 Gene [Source:MGI Symbol;Acc:MGI:1914751]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41904 Nonsense Mutation detected in F1 DNA During 2017
sa35150 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130278 Nonsense 29 346 2 11
Genomic Location (Zv9):
Chromosome 11 (position 41524550)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 39784231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCCCCTCAGTGTGCCAGTGTTTCTCCGTTTTAGAGGATGGTGCTT[T/A]GGCTCAAAGTCTTCAAGAGCAGGAAAGTCAGTATAATCGTTCCCTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130278 Essential Splice Site 229 346 8 11
Genomic Location (Zv9):
Chromosome 11 (position 41543584)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 39803265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATCTGATGAAGAAGGCAGAGATGAAGAAAACACAACCACCAGGAAGG[T/A]CTGAATGAAGCTCACACACACACACGTATGTTTGTTTTTGTGAAAAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link