CC2D2A

Ensembl ID:
ENSDARG00000090971
Description:
coiled-coil and C2 domain containing 2A [Source:HGNC Symbol;Acc:29253]
Human Orthologue:
CC2D2A
Human Description:
coiled-coil and C2 domain containing 2A [Source:HGNC Symbol;Acc:29253]
Mouse Orthologue:
Cc2d2a
Mouse Description:
coiled-coil and C2 domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:1924487]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
e50 Nonsense Available for shipment Available now
sa16835 Nonsense Available for shipment Available now
sa10580 Essential Splice Site Available for shipment Available now
sa24244 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
e50
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 223 1666 9 38
Genomic Location:
Chromosome 23 (position 2220817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTGCTGATCAGGTTGAGGCTGGTTTGCCGACCGCCGAAGAGGCCTA[C/A]AACTTCTTCACCTTCAACTTTGACCCGGAGCCTGAACAGCAGCGCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 440 1666 13 38
Genomic Location:
Chromosome 23 (position 2230216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTGTTCGCTCTGTCTCAGGCTCTGAAGTCGAAGCATGTGAACCTCTA[T/A]ATAGCTGGAATGGGGGATCMTCAGGCAGACTACCARCTGGATGTAGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Essential Splice Site 501 1666 14 38
Genomic Location:
Chromosome 23 (position 2230480)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTCCTCAAGCTCTCGCTYTTGAAACTCAGTCTGAATGTGTGTGTGTA[G/A]TTGAACAGCTTGAGGAACACGATTCATARCATGCTGGAGCTGCACAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Essential Splice Site 827 1666 19 38
Genomic Location:
Chromosome 23 (position 2238198)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCAGCAACCAGAGAGTCACATTCAATCACGAGGGGGTCGGCAGTGG[T/C]GAGAGCTCTTTTTAAATATATACAAATAAAATGTTTTTCAGTGCACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126768 Nonsense 1368 1666 31 38
Genomic Location:
Chromosome 23 (position 2263934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTCTRAAYCCACCACAGGAGCTGCTGGAYGCTTCYCCCAACGGCACA[C/T]AGGACAGCACGGTTCGCCCTCCACTGACAGACACTYTTMTGTCWCTCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/378ty5dx