IGSF5 (2 of 2)

Ensembl ID:
ENSDARG00000090953
Description:
immunoglobulin superfamily, member 5 [Source:HGNC Symbol;Acc:5952]
Human Orthologue:
IGSF5
Human Description:
immunoglobulin superfamily, member 5 [Source:HGNC Symbol;Acc:5952]
Mouse Orthologue:
Igsf5
Mouse Description:
immunoglobulin superfamily, member 5 Gene [Source:MGI Symbol;Acc:MGI:1919308]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13498 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126886 Nonsense 167 255 3 4
Genomic Location:
Chromosome 15 (position 5898462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCRGTGTTGTGGATGGTCAATGGCACCAGCGTGGACAGAGGCGACTA[C/A]AACACCAGCAGTATTCAAGGAACCAACGACCTGTTTAACTCCACCASTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/twrfkmni