C1orf216

Ensembl ID:
ENSDARG00000090951
Description:
chromosome 1 open reading frame 216 [Source:HGNC Symbol;Acc:26800]
Human Orthologue:
C1orf216
Human Description:
chromosome 1 open reading frame 216 [Source:HGNC Symbol;Acc:26800]
Mouse Orthologue:
5730409E04Rik
Mouse Description:
RIKEN cDNA 5730409E04Rik gene Gene [Source:MGI Symbol;Acc:MGI:3609248]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5930 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130929 Nonsense 168 309 1 1
Genomic Location:
Chromosome 19 (position 50154826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNTGATTGATTGGGGAAACAGCGATGATGAAGATTTCGAGTTCAGCTA[T/G]AAGTCTGAGAGCTCCAGCATGGACAGCGCAGGAGCCAAGAACTCCATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d9ggtxww