LOC100333695

Ensembl ID:
ENSDARG00000090946
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42851 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42852 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113401 Essential Splice Site 50 1175 1 10
Genomic Location (Zv9):
Chromosome 17 (position 4168033)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4242868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGAGCCCTCCTGAATTCAGTGACGGAGCAGTGACATCTGTCCCTGAG[T/C]GAGTTTAAAAACTTTGATTTAACTGTATATATATATTGAGTGAATGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113401 Nonsense 857 1175 6 10
Genomic Location (Zv9):
Chromosome 17 (position 4174928)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 4249763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGCAGGATTCAGGAGTGAAGCTGCTCTCTGATGGACTGAAGAGTTG[T/A]CAACTCAACACACTGAGGTAAGAAAGAAGGATAAAGATTTGTTTGGGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link