ENSDARG00000090945

Ensembl ID:
ENSDARG00000090945
Human Orthologues:
CLEC4A, CLEC4C, CLEC4D, CLEC4E, CLEC6A
Human Descriptions:
C-type lectin domain family 4, member A [Source:HGNC Symbol;Acc:13257]
C-type lectin domain family 4, member C [Source:HGNC Symbol;Acc:13258]
C-type lectin domain family 4, member D [Source:HGNC Symbol;Acc:14554]
C-type lectin domain family 4, member E [Source:HGNC Symbol;Acc:14555]
C-type lectin domain family 6, member A [Source:HGNC Symbol;Acc:14556]
Mouse Orthologues:
Clec4a1, Clec4a2, Clec4a3, Clec4a4, Clec4b1, Clec4b2, Clec4d, Clec4e, Clec4n
Mouse Descriptions:
C-type lectin domain family 4, member a1 Gene [Source:MGI Symbol;Acc:MGI:3036291]
C-type lectin domain family 4, member a2 Gene [Source:MGI Symbol;Acc:MGI:1349412]
C-type lectin domain family 4, member a3 Gene [Source:MGI Symbol;Acc:MGI:1920399]
C-type lectin domain family 4, member a4 Gene [Source:MGI Symbol;Acc:MGI:3624119]
C-type lectin domain family 4, member b1 Gene [Source:MGI Symbol;Acc:MGI:1917060]
C-type lectin domain family 4, member b2 Gene [Source:MGI Symbol;Acc:MGI:3588267]
C-type lectin domain family 4, member d Gene [Source:MGI Symbol;Acc:MGI:1298389]
C-type lectin domain family 4, member e Gene [Source:MGI Symbol;Acc:MGI:1861232]
C-type lectin domain family 4, member n Gene [Source:MGI Symbol;Acc:MGI:1861231]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21352 Nonsense Mutation detected in F1 DNA During 2014
sa21351 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122094 Nonsense 92 209 4 6
Genomic Location:
Chromosome 8 (position 41699393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATACAGGTCTCTGCTCAGATGGTTGGCTTTTATATAAGAACACCTG[T/A]TATTTGTTAGAGAATGTTTATGGGACATGGAAATCCTCAAAGTCTTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122094 Essential Splice Site 163 209 6 6
Genomic Location:
Chromosome 8 (position 41695919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGCTTACACATTGTCTTCTAAATTGATTGTGTTTTGTGTACTTTTC[A/C]GTTTCTGGGATGAAAATCAGCCTGCTCATGGTGGTATGGAGTCCTGTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/367o553v