LIMD1 (2 of 2)

Ensembl ID:
ENSDARG00000090937
Description:
LIM domains containing 1 [Source:HGNC Symbol;Acc:6612]
Human Orthologue:
LIMD1
Human Description:
LIM domains containing 1 [Source:HGNC Symbol;Acc:6612]
Mouse Orthologue:
Limd1
Mouse Description:
LIM domains containing 1 Gene [Source:MGI Symbol;Acc:MGI:1352502]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29126 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43203 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126419 Essential Splice Site 130 173 6 7
Genomic Location (Zv9):
Chromosome 19 (position 3329151)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2930583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTATTAGCTAATTCAAATCATTTGTCATATATTTTTTTGTCTTGTAC[A/T]GGTTTTTAGCCCAGACCTGTGCTGTATGTGAGCAGCTCATCCTTCCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126419 Nonsense 141 173 6 7
Genomic Location (Zv9):
Chromosome 19 (position 3329118)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2930550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTTGTCTTGTACAGGTTTTTAGCCCAGACCTGTGCTGTATGTGAG[C/T]AGCTCATCCTTCCCATTGAGGCATGTTTACATTTTCACTTGTTTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link