or128-4

Ensembl ID:
ENSDARG00000090931
ZFIN ID:
ZDB-GENE-070806-109
Description:
odorant receptor, family E, subfamily 128, member 4 [Source:RefSeq peptide;Acc:NP_001122050]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39032 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123819 Nonsense 4 306 1 2
ENSDART00000128924 Nonsense 4 305 1 1
Genomic Location (Zv9):
Chromosome 15 (position 5081386)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5231439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGTCACTGATGGAAAACCTTGGTGCTTAAAGCAAAATGGAAAACTA[T/A]ACCAGTTTTAACTTCATGTTGTTTGAAAATCTAGGGTACATAAGATATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link