ENSDARG00000090923

Ensembl ID:
ENSDARG00000090923

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9029 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122752 Nonsense 280 803 1 4
Genomic Location:
Chromosome 15 (position 3296757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAGAAAWCCAAYCAGYTATTGACTCTGTAAGATGCGAGAGCTCAGGT[C/T]AACTCACAAATGGTATGAGTGAATGTAGCATTACAAGAATCACAAATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2f3kwpax