LOC570784

Ensembl ID:
ENSDARG00000090920
Human Orthologue:
SMCHD1
Human Description:
structural maintenance of chromosomes flexible hinge domain containing 1 [Source:HGNC Symbol;Acc:290
Mouse Orthologue:
Smchd1
Mouse Description:
SMC hinge domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921605]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27111 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129984 Nonsense 143 399 5 10
Genomic Location (Zv9):
Chromosome 7 (position 75305861)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 71376849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGAACGGGACGCCGGTCAACTTTAAAGTGGAGGTTCATGATGAGTGC[C/T]AGAATATCACCGCTCATCCTAAACTCGCCGTCCGCTGCCAGGTGACGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link