NP_001099150.1

Ensembl ID:
ENSDARG00000090918
Description:
hypothetical protein LOC564835 [Source:RefSeq peptide;Acc:NP_001099150]
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35244 Nonsense Mutation detected in F1 DNA During 2017
sa24907 Nonsense Mutation detected in F1 DNA During 2017
sa35245 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35246 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123363 Nonsense 10 336 2 8
Genomic Location (Zv9):
Chromosome 12 (position 17583826)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 12559521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTAGTCCTCCAGGCAGGATGATGTTTGCTTTGCTCGTCACGCTGTG[C/A]ATAAGTGCAGTGTTTGCTGCTTCATCTATAGACATCCAGTTAGATGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123363 Nonsense 189 336 5 8
Genomic Location (Zv9):
Chromosome 12 (position 17584991)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 12560686
KASP Assay ID:
554-7588.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCACATGGCAATCAAGGGTGTAATGGAGGCCTCATGGACCAGGCCTTC[C/T]AGTATGTTAAAGAAAACAAGGGGCTGGATTCTGAGCAGTCATACCCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123363 Essential Splice Site 208 336 5 8
Genomic Location (Zv9):
Chromosome 12 (position 17585051)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 12560746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAACAAGGGGCTGGATTCTGAGCAGTCATACCCTTATCTTGCAAGG[G/A]TAAGAATCATATTGTGACCGTTTCTGAGCAAGGAAAACTCTTTTGAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123363 Nonsense 260 336 6 8
Genomic Location (Zv9):
Chromosome 12 (position 17585389)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 12561084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGTGGGTCCTGTATCTGTTGCTATTGACGCATCACATCAATCCCTA[C/T]AGTTCTATCAGTCTGGTAGGTGTCTGATATCCCTCAACTCTAGTTTTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link