ENSDARG00000090910

Ensembl ID:
ENSDARG00000090910
Human Orthologue:
ZBED4
Human Description:
zinc finger, BED-type containing 4 [Source:HGNC Symbol;Acc:20721]
Mouse Orthologue:
Zbed4
Mouse Description:
zinc finger, BED domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2682302]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18679 Nonsense Available for shipment Available now
sa42086 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125040 Nonsense 64 528 3 4
Genomic Location (Zv9):
Chromosome 12 (position 38941144)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37228558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTTTTYTGTTCTTWTAGGGAGAAAGTTTCTCCATGGCAGGCCTTTTT[T/A]ACRTGTCCAAACAAACCAACAARCCCAGCCTCATATTCAACAAGAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125040 Nonsense 175 528 4 4
Genomic Location (Zv9):
Chromosome 12 (position 38941565)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 37228979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTGTGGCCGGTCACCTAATCAATGAAAACTGGGAACTGAAATCATA[T/A]GTGCTCGATACGGCACATTTAATCCACAAAAGCACAGCTGAAAGTGTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link