KIAA1267 (2 of 2)

Ensembl ID:
ENSDARG00000090895
Description:
KIAA1267 [Source:HGNC Symbol;Acc:24565]
Human Orthologue:
KIAA1267
Human Description:
KIAA1267 [Source:HGNC Symbol;Acc:24565]
Mouse Orthologue:
1700081L11Rik
Mouse Description:
RIKEN cDNA 1700081L11 gene Gene [Source:MGI Symbol;Acc:MGI:1923969]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35197 Nonsense Mutation detected in F1 DNA During 2017
sa22010 Essential Splice Site Available for shipment Available now
sa41949 Nonsense Mutation detected in F1 DNA During 2017
sa27868 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128145 Nonsense 99 998 1 15
Genomic Location (Zv9):
Chromosome 12 (position 5288633)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4655631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCATCTCTGGGCAAGCTGGCACCTTACTTGTGCTCTGATGTCAAACCAT[T/A]GCCCTCATCCACCAAAGTCAAGGAGTCGCTGAAGCTGCAAGGTGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128145 Essential Splice Site 549 998 3 15
Genomic Location (Zv9):
Chromosome 12 (position 5269274)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4674990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTCGCTTGACGGACGCATCTGAGAACATTGTCTCCATTAGGTTCTGA[T/A]CAGTTTAATTATTTCAATGAATGTTGTTGTGTTTTAGTATTTAAAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128145 Nonsense 658 998 7 15
Genomic Location (Zv9):
Chromosome 12 (position 5266317)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4677947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTGATGTGTGGCAGCGCTCGATCCCTCCTGAAAGCAGACTCGCCGTA[T/A]GATCGCCCTCTGCTGGAGAGAGTCGCACATCACGACCGCAGTGTCCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128145 Essential Splice Site 749 998 9 15
Genomic Location (Zv9):
Chromosome 12 (position 5260365)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4683899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATATGTGTGTGAATTGTATTTGTGTTTTTTCCTTTTTTTAAGTA[G/A]CACCGAAAGTGGTGATGGATGCAGGCAGTCCATGTCCGTCTCTGTCCGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link