or117-1

Ensembl ID:
ENSDARG00000090892
ZFIN ID:
ZDB-GENE-070806-79
Description:
odorant receptor, family F, subfamily 117, member 1 [Source:RefSeq peptide;Acc:NP_001121860]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127284 Nonsense 116 326 1 1
Genomic Location:
Chromosome 15 (position 30605893)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTTCTCCARGCTTTTTTGATACATTTATATGGAGGTGGAACACTTTTTT[T/A]ACTGGCAGCCATGTCCTTAGACCGATACATAGCAATATGCAATCCACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xevac7ap