cmklr1

Ensembl ID:
ENSDARG00000090890
ZFIN ID:
ZDB-GENE-060526-126
Description:
chemokine-like receptor 1 [Source:RefSeq peptide;Acc:NP_001076281]
Human Orthologue:
CMKLR1
Human Description:
chemokine-like receptor 1 [Source:HGNC Symbol;Acc:2121]
Mouse Orthologue:
Cmklr1
Mouse Description:
chemokine-like receptor 1 Gene [Source:MGI Symbol;Acc:MGI:109603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26444 Nonsense Mutation detected in F1 DNA During 2016
sa12392 Nonsense Available for shipment Available now
sa33572 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130911 Nonsense 155 353 1 1
ENSDART00000137019 Nonsense 155 353 2 2
Genomic Location:
Chromosome 5 (position 22373297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCATCAGCGTGGACCGTTGCGTCGCCGTCATGTTCCCCGTTTGGGCA[C/T]AAAATCACCGCACCATTGGAAAAGCATCGGTGTTGATCATACTTGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130911 Nonsense 244 353 1 1
ENSDART00000137019 Nonsense 244 353 2 2
Genomic Location:
Chromosome 5 (position 22373564)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTTGCTACACGGTCATYATCGTCAGGCTGAGAGCTTCCAARATGGCC[A/T]AATYCAACAARCCATTTARGATCATGACAGCTCTYATCCTGACCTTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130911 Nonsense 305 353 1 1
ENSDART00000137019 Nonsense 305 353 2 2
Genomic Location:
Chromosome 5 (position 22373749)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGGCACCATCACTGCTGCCGCAAACAGCTTCCTGAACCCTGTGTTGTA[C/G]GTGTTCATGGGCAATGACTTCAGAAAGAGGTTCAAGAGTTCCATCTTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link