LOC793246

Ensembl ID:
ENSDARG00000090889
Human Orthologue:
LECT2
Human Description:
leukocyte cell-derived chemotaxin 2 [Source:HGNC Symbol;Acc:6550]
Mouse Orthologue:
Lect2
Mouse Description:
leukocyte cell-derived chemotaxin 2 Gene [Source:MGI Symbol;Acc:MGI:1278342]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6351 Nonsense Mutation detected in F1 DNA During 2014
sa15673 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124159 Nonsense 53 165 3 5
Genomic Location:
Chromosome 14 (position 38211981)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGCAGTGGAAACAAAGATAACAYGAAAAGAGGATGTGATGTAAACTA[T/A]GGTTGTGGACAYTATGGAGCCAGCCGGTAAATCGTGACTTTTTGTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15673
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124159 Essential Splice Site 110 165 4 5
Genomic Location:
Chromosome 14 (position 38214087)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGGAAATAACAATGYCATTGATGATGGGATAACCTTAATGGSTGAAG[G/A]TTTGTACTGTCATCACATATATAAGTTAGTCAAATGTTTCACAAAGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y8bd0mk4