ENSDARG00000090886

Ensembl ID:
ENSDARG00000090886

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18318 Essential Splice Site Available for shipment Available now
sa21629 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 216 507 9 18
Genomic Location:
Chromosome 10 (position 2563046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACATTTGAACATCTGAGTGTTATGAGACANNATACTGTATGTTTCCCCAT[A/T]GAGACYCTGCTGTGGGAACAGTTTAAAGTAAAGGGAGATTCTCCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 330 507 13 18
Genomic Location:
Chromosome 10 (position 2568637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTAATTATCATTATACTTGAGATTGATTTGTAATTCCCTTTTCTTCA[G/A]TGATGAAGGAGATTTTATCGGAGTTCGGCCTGCAGGGTGTCAGTAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9579q5ig