ENSDARG00000090886

Ensembl ID:
ENSDARG00000090886

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34807 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18318 Essential Splice Site Available for shipment Available now
sa34808 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34809 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21629 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 216 507 8 18
Genomic Location:
Chromosome 10 (position 2562962)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCAGAGGACGGATCTCTGCTTAAAGACATGTACGCCCTCAATACAGG[T/C]ATAACTACGATCAAACGGGTTTCCAAATCGTGCACACATTTGAACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 216 507 9 18
Genomic Location:
Chromosome 10 (position 2563046)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACATTTGAACATCTGAGTGTTATGAGACANNATACTGTATGTTTCCCCAT[A/T]GAGACYCTGCTGTGGGAACAGTTTAAAGTAAAGGGAGATTCTCCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 244 507 9 18
Genomic Location:
Chromosome 10 (position 2563135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCTGTTGTTTGTGCTGGTCAAACCTTTACGCCACATCATGACAAGG[T/C]AACACGGTTTTACTACAGTTTCCACTACATTTATATACATTTATAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 245 507 10 18
Genomic Location:
Chromosome 10 (position 2565877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTTGGTTATGATTTTTCTGTTCTCTTCCACTACTGCTTTTGACCCC[A/T]GGATATTTACTTGTTTGGAGGAACGGTCAGCAGTCCTGACGGAGGGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123467 Essential Splice Site 330 507 13 18
Genomic Location:
Chromosome 10 (position 2568637)
KASP Assay ID:
2260-2736.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTAATTATCATTATACTTGAGATTGATTTGTAATTCCCTTTTCTTCA[G/A]TGATGAAGGAGATTTTATCGGAGTTCGGCCTGCAGGGTGTCAGTAACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link