si:ch211-113k9.1

Ensembl ID:
ENSDARG00000090883
ZFIN ID:
ZDB-GENE-091204-365
Human Orthologue:
GABRA3
Human Description:
gamma-aminobutyric acid (GABA) A receptor, alpha 3 [Source:HGNC Symbol;Acc:4077]
Mouse Orthologue:
Gabra3
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95615]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10277 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122393 Nonsense 266 294 7 7
ENSDART00000142810   None 51 None 2
Genomic Location (Zv9):
Chromosome 21 (position 43145915)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44456995
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATATTTCCATTTGAAAAGGAAAATTGGCTATTTCGTGATCCAGAYGTA[T/A]CTGCCCTGCATAATGACCGTCATATTATCTCAGGTCTCCTTCTGGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link