KIAA0317

Ensembl ID:
ENSDARG00000090858
Description:
KIAA0317 [Source:HGNC Symbol;Acc:20363]
Human Orthologue:
KIAA0317
Human Description:
KIAA0317 [Source:HGNC Symbol;Acc:20363]
Mouse Orthologue:
1110018G07Rik
Mouse Description:
RIKEN cDNA 1110018G07 gene Gene [Source:MGI Symbol;Acc:MGI:1915747]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4727 Splice Site, Nonsense F2 line generated During 2014
sa23188 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4727
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125532 Splice Site, Nonsense 558 1020 10 21
Genomic Location:
Chromosome 17 (position 50035338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCTTCTTGTCGTTACTCTTAATAACAACTCATTGTATTGTGTTCCAG[C/T]AATTTTCTGTGAAGGAGTTTTACCTGAAAATTATTCCTTGGCGCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125532 Nonsense 644 1020 12 21
Genomic Location:
Chromosome 17 (position 50035759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCTTATAGGAGGATCAGAGACTTTTCAGGATAAAGTGAACTTTTTT[C/T]AAAGGGAGCTAAGGCACATCCACTCCAAGAGACCTCGCACTAAAACTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b3tvu8vs