KIAA0317

Ensembl ID:
ENSDARG00000090858
Description:
KIAA0317 [Source:HGNC Symbol;Acc:20363]
Human Orthologue:
KIAA0317
Human Description:
KIAA0317 [Source:HGNC Symbol;Acc:20363]
Mouse Orthologue:
1110018G07Rik
Mouse Description:
RIKEN cDNA 1110018G07 gene Gene [Source:MGI Symbol;Acc:MGI:1915747]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4727 Splice Site, Nonsense F2 line generated During 2016
sa23188 Nonsense Available for shipment Available now
sa36529 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4727
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125532 Splice Site, Nonsense 558 1020 10 21
Genomic Location:
Chromosome 17 (position 50035338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCTTCTTGTCGTTACTCTTAATAACAACTCATTGTATTGTGTTCCAG[C/T]AATTTTCTGTGAAGGAGTTTTACCTGAAAATTATTCCTTGGCGCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23188
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125532 Nonsense 644 1020 12 21
Genomic Location:
Chromosome 17 (position 50035759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCTTATAGGAGGATCAGAGACTTTTCAGGATAAAGTGAACTTTTTT[C/T]AAAGGGAGCTAAGGCACATCCACTCCAAGAGACCTCGCACTAAAACTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125532 Nonsense 788 1020 15 21
Genomic Location:
Chromosome 17 (position 50044660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGTACGAGCCCGATTCACCCGCTCCTTCTTGGCTCAGATAATTGGAT[T/A]GCGAATGAACTATAAGGTAACAACTGATTCATAACCTGCTGATAAATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link