PCSK6

Ensembl ID:
ENSDARG00000090857
Description:
proprotein convertase subtilisin/kexin type 6 [Source:HGNC Symbol;Acc:8569]
Human Orthologue:
PCSK6
Human Description:
proprotein convertase subtilisin/kexin type 6 [Source:HGNC Symbol;Acc:8569]
Mouse Orthologue:
Pcsk6
Mouse Description:
proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12153 Nonsense Available for shipment Available now
sa40836 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131198 Nonsense 40 817 2 19
Genomic Location (Zv9):
Chromosome 7 (position 9941138)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGGTRAGGTTGGTTGATGATTTCTTTATCTTAYTGTGTTTCAGCACTG[T/A]AGTGATAAAAACAGCCGCTGTCGTTCAGAAATGAATATCCTCGGGGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131198 Essential Splice Site 199 817 5 19
Genomic Location (Zv9):
Chromosome 7 (position 9957384)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8891886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGGCCGGGGCCGCTCGCCAAGCAAGCCTTTGAGCTGGGAAGTAAAAAG[G/T]TTGTTGTCTGAATCACTTCACGCACAAACACAAGCGCTTTCTCACCAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link