serpina1l

Ensembl ID:
ENSDARG00000090850
ZFIN ID:
ZDB-GENE-040721-3
Description:
serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1,
Human Orthologue:
SERPINA10
Human Description:
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 [Source:HGNC Sy
Mouse Orthologues:
Gm46, Serpina10
Mouse Descriptions:
predicted gene 46 Gene [Source:MGI Symbol;Acc:MGI:2684892]
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 G

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32277 Nonsense Available for shipment Available now
sa6618 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124111 Nonsense 104 434 2 5
ENSDART00000129762 Nonsense 99 429 1 4
Genomic Location (Zv9):
Chromosome 20 (position 10726684)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10552358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCAAGGCAAGAACATTTTCTTCTCCCCAGTTGGCATCTCAATGGCTT[T/A]GAGCTTGCTGGCTGTAGGTGCCAAGGGCAGCACTCTTTCACAGATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124111 Nonsense 137 434 2 5
ENSDART00000129762 Nonsense 132 429 1 4
Genomic Location (Zv9):
Chromosome 20 (position 10726784)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10552458
KASP Assay ID:
554-5218.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGTCTAGGTTACAGTGCACTGACGCCTGAGCAGGTAAATGAGGGTTA[T/A]GAGCACTTGCTCCACATGTTGGGTCACAGTCAGGATGCCATGCAGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link