tmem132e

Ensembl ID:
ENSDARG00000090830
Human Orthologue:
TMEM132E
Human Description:
transmembrane protein 132E [Source:HGNC Symbol;Acc:26991]
Mouse Orthologue:
Tmem132e
Mouse Description:
transmembrane protein 132E Gene [Source:MGI Symbol;Acc:MGI:2685490]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12566 Nonsense Available for shipment Available now
sa12525 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130565 Nonsense 318 631 5 5
ENSDART00000130565 Nonsense 318 631 5 5
Genomic Location:
Chromosome 5 (position 62375070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCTCAATGGCACTTCAGMGGATGATAAGGTGGTCACGGTGGCACAA[C/T]AACCCCAACAGCGGTGGCCAGTCRTCATCGCTGAGGGTGAGGGCACAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130565 Nonsense 318 631 5 5
ENSDART00000130565 Nonsense 318 631 5 5
Genomic Location:
Chromosome 5 (position 62375070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACCTCAATGGCACTTCAGMGGATGATAAGGTGGTCACGGTGGCACAA[C/T]AACCCCAACAGCGGTGGCCAGTCRTCATCGCTGAGGGTGAGGGCACAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ibjqxttq