KCNJ10 (1 of 2)

Ensembl ID:
ENSDARG00000090815
Description:
potassium inwardly-rectifying channel, subfamily J, member 10 [Source:HGNC Symbol;Acc:6256]
Human Orthologue:
KCNJ10
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 10 [Source:HGNC Symbol;Acc:6256]
Mouse Orthologue:
Kcnj10
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 10 Gene [Source:MGI Symbol;Acc:MGI:119450

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31549 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124851 Essential Splice Site 191 425 2 5
Genomic Location (Zv9):
Chromosome 7 (position 7413366)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6453314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACAATGGTGATGGAGATCTTCATCACGGGAACCTTCCTCGCCAAGG[T/C]ATAGCTCTCACAATTGAGAAACAATAATTTGCAAACCCAGGCGATTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link