si:dkey-175c11.1

Ensembl ID:
ENSDARG00000090797
ZFIN ID:
ZDB-GENE-050309-42
Description:
hypothetical protein LOC793922 [Source:RefSeq peptide;Acc:NP_001119926]
Human Orthologue:
C12orf34
Human Description:
chromosome 12 open reading frame 34 [Source:HGNC Symbol;Acc:25915]
Mouse Orthologue:
BC057022
Mouse Description:
cDNA sequence BC057022 Gene [Source:MGI Symbol;Acc:MGI:3605543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128886 Nonsense 106 435 2 4
ENSDART00000131924 Nonsense 157 527 2 2
Genomic Location (Zv9):
Chromosome 5 (position 21535110)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19247982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCAGRAGGACTAAGTTGTCTCCTGCRMAAATAGCAGWGGCTCCTTA[T/A]CCACCTCCCAACAGCAGCACTTTAGGTCATTGCCATGGACAGATTGTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link