HECW1 (2 of 2)

Ensembl ID:
ENSDARG00000090795
Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Human Orthologue:
HECW1
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Mouse Orthologue:
Hecw1
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:2444

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15027 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090301 Essential Splice Site 353 494 9 12
Genomic Location:
Chromosome 24 (position 216070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGGGGGTCATGCAGCAAGCCGAAGCCCTTGTYAGGGGTTTCTATGAG[G/A]TACAAAAGCTGGAACAGTAGACGATCCACACACAGGAAGCAATTACAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7z2sjplu