si:dkey-109j17.6

Ensembl ID:
ENSDARG00000090787
ZFIN ID:
ZDB-GENE-090313-174
Human Orthologue:
KLHDC8B
Human Description:
kelch domain containing 8B [Source:HGNC Symbol;Acc:28557]
Mouse Orthologue:
Klhdc8b
Mouse Description:
kelch domain containing 8B Gene [Source:MGI Symbol;Acc:MGI:1925517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43945 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123961 Nonsense 355 359 5 5
ENSDART00000132543 Nonsense 351 355 5 6
Genomic Location (Zv9):
Chromosome 23 (position 19539090)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 19324197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGGAGGGGTGTCGCAGGGTCCCAGTAACGCTGTGGAAGCCCTCTGTT[T/A]GAAAGAGACTGTCTGACAAACACACATACAAATGAACAGCTACACAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link