ENSDARG00000090782

Ensembl ID:
ENSDARG00000090782

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44426 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123135 Essential Splice Site 218 448 4 4
Genomic Location (Zv9):
Chromosome Zv9_NA851 (position 38087)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150703.1 38087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGCTCAGATACTGAGAAGACTTCCTCACAGAAAAGAACTAAAAAAAAC[A/T]GAGGTGAAAAATCTTTCCTCTGCCAACAGTGTGGAAAGAGTTTTAGGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link