ENSDARG00000090777

Ensembl ID:
ENSDARG00000090777
Human Orthologue:
PKD1
Human Description:
polycystic kidney disease 1 (autosomal dominant) [Source:HGNC Symbol;Acc:9008]
Mouse Orthologue:
Pkd1
Mouse Description:
polycystic kidney disease 1 homolog Gene [Source:MGI Symbol;Acc:MGI:97603]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35282 Nonsense Mutation detected in F1 DNA During 2017
sa38887 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121852 Nonsense 164 893 1 5
Genomic Location (Zv9):
Chromosome 12 (position 23065614)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21588977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTACTGATGCTCTTTGGCTCGGCGGGACCAGGAAATGTCCTGCATT[G/A]GGAATGGGTTTTAACATTGCACAATAGAACTGTTGTGGTTCTTACCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38887
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121852 Nonsense 513 893 1 5
Genomic Location (Zv9):
Chromosome 12 (position 23066662)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 21590025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGCAAGAGTGGACTTCAACGGTTGTGTTACACACAAAGCATCTTA[T/A]ATCTGGGAGATCTTCAGAGGTCCAGATTGCCCAGGAATGAACAAGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link