LOC100000629

Ensembl ID:
ENSDARG00000090767

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21998 Nonsense Mutation detected in F1 DNA During 2014
sa7684 Nonsense Mutation detected in F1 DNA During 2014
sa16534 Nonsense Available for shipment Available now
sa17646 Nonsense Available for shipment Available now
sa13472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126100 Nonsense 264 1901 2 6
Genomic Location:
Chromosome 12 (position 4671180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGCTTGAAACACTGAATTTATTAGACACATATTCTGATAAAGTTTA[T/A]AAATTATCTAAAAATGAGCTTGATCAGAGACCTGGTACCGAGGGTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126100 Nonsense 672 1901 2 6
Genomic Location:
Chromosome 12 (position 4669958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKAATGATCAGRGGGAAAAYGAGAAGGATGAAGAAACAGCACTTAAATCA[C/T]AATCAGAAGATGTGCTTCCTCAGWTTAAATATTCMATCGAGGACACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126100 Nonsense 795 1901 2 6
Genomic Location:
Chromosome 12 (position 4669589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGCTGTYAGATTYAAAACAGGATACTCCAGAAAATWCTACAGAAACA[G/T]GAACTGGATCGCCRGTCGTTSCTGTAAACACTGAAGGCATGTTTTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126100 Nonsense 1108 1901 2 6
Genomic Location:
Chromosome 12 (position 4668650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTTCMCCAAAGCTTGAAAYAACTGAAGCTGAGAGACATCAYGAGCAA[C/T]AAACTCATYATTGTGSAGAGTTATCAACTRGAACTGATTRTTTAGCRACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126100 Nonsense 1769 1901 3 6
Genomic Location:
Chromosome 12 (position 4663960)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTTGTTATATACTAGGACTCMTCTTTGGACTTCACCRTTCAGAAGTCT[A/T]GAATAGCAGTGAAGAATYCTYTAGTTCGGCCCCCCAAAGACCCCAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/79x6n3pd