LOC566782

Ensembl ID:
ENSDARG00000090765
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20606 Nonsense Available for shipment Available now
sa13442 Essential Splice Site Available for shipment Available now
sa40618 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124082 Nonsense 548 832 1 5
Genomic Location (Zv9):
Chromosome 6 (position 1333400)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 722157
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACGATTCGTTATATAAGCAAACGAAAGAATACTTAAGGACAAATT[T/A]AGGAAAACCCCTGTCATCCTCCATGTGTTCACTGCTGGCGTACGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124082 Essential Splice Site 658 832 3 5
Genomic Location (Zv9):
Chromosome 6 (position 1335704)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 719853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAAAATAAAATTGATTTAAAAATCTGTACATTTCATTACTTTTATTT[A/T]GAATGGGATCYTGTAATCTCACCGGTCAGTGCKGTGAGAGTTTATCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124082 Nonsense 811 832 5 5
Genomic Location (Zv9):
Chromosome 6 (position 1338702)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 716855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCCATTTGTTAGAGCTGGATCTGAGTTTCAATGACCTGCAGGATTCA[G/T]GAGTGATTCTGCTCTGTGATGGACTGAAGAGCCCAAACTGCCAGCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link