LOC566782

Ensembl ID:
ENSDARG00000090765
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20606 Nonsense Mutation detected in F1 DNA During 2014
sa13442 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124082 Nonsense 548 832 1 5
Genomic Location:
Chromosome 6 (position 1333400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACGATTCGTTATATAAGCAAACGAAAGAATACTTAAGGACAAATT[T/A]AGGAAAACCCCTGTCATCCTCCATGTGTTCACTGCTGGCGTACGTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124082 Essential Splice Site 658 832 3 5
Genomic Location:
Chromosome 6 (position 1335704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAAAATAAAATTGATTTAAAAATCTGTACATTTCATTACTTTTATTT[A/T]GAATGGGATCYTGTAATCTCACCGGTCAGTGCKGTGAGAGTTTATCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gskcpy52