ENSDARG00000090758

Ensembl ID:
ENSDARG00000090758

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22827 Nonsense Mutation detected in F1 DNA During 2016
sa14398 Nonsense Available for shipment Available now
sa42712 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 22 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062189)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22966505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACCAGGCATTACGTATTGTCTCTTGGAACACTATGGGAATCAGGTA[C/A]ACAAAAGAAAAAAGCTCCAAGCTCCAGCTTGTGTTGGATGATCTCGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 136 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062531)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22966847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTACAATCACCAGGCAGACAGAGATATGCTGGGCAGAYTGAGAGACTA[T/A]TTGACAGCYATTAACACTAAAGGTGTGCTTGTGGTTGGTGGAGACTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125201 Nonsense 193 515 1 1
Genomic Location (Zv9):
Chromosome 16 (position 25062701)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22967017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTTGAAGACTTCACACAATTTCTGAGTCTTGAAGATGTATTTGCAT[T/A]AAGGCACCCAATGGAAGAAGGCTTCACACGATCTCAGAGTCAGAGTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link