PLK2 (1 of 2)

Ensembl ID:
ENSDARG00000090752
Description:
polo-like kinase 2 [Source:HGNC Symbol;Acc:19699]
Human Orthologue:
PLK2
Human Description:
polo-like kinase 2 [Source:HGNC Symbol;Acc:19699]
Mouse Orthologue:
Plk2
Mouse Description:
polo-like kinase 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1099790]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34816 Nonsense Mutation detected in F1 DNA During 2017
sa16187 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125299 Nonsense 183 678 4 14
Genomic Location (Zv9):
Chromosome 10 (position 4325439)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4478448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGATTGTCTCGGGACTGAAGTATCTACATGAGCAAGAGATTCTGCAC[A/T]GAGACCTTAAACTAGGTAAGTGACTACAGCACACATTCGACTAGCATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125299 Nonsense 304 678 6 14
Genomic Location (Zv9):
Chromosome 10 (position 4324185)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 4479702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTCATTAGCAGTATGYTGGCCAAGAATCCTGTGGATAGGCCACAAT[T/A]GTGTGATATTCTTCGCCATGACTTTTTCTGCCAGGTGTGTGCGCTTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link