ENSDARG00000090740

Ensembl ID:
ENSDARG00000090740

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13512 Nonsense Available for shipment Available now
sa30828 Nonsense Mutation detected in F1 DNA During 2016
sa39985 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 149 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415917)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6955061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGGAGAAGCCTTATTCATGCTCTGTGTGTGGAAAGAGTTTCTCATA[T/A]CAAGGAAACTTAGGAAAACATCAGACKATTCACACTGGTGTGAGAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 190 306 2 2
ENSDART00000128960 Nonsense 190 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6954940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTCGTACGGCTGAAGACTTGAAAGTACATGAGAGGATTCACACT[G/T]GAGAGAGACCTTACAAGTGTTCACACTGCGACAAGAGATTTAATCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 190 306 2 2
ENSDART00000128960 Nonsense 190 306 2 2
Genomic Location (Zv9):
Chromosome 3 (position 7415796)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6954940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTCGTACGGCTGAAGACTTGAAAGTACATGAGAGGATTCACACT[G/T]GAGAGAGACCTTACAAGTGTTCACACTGCGACAAGAGATTTAATCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link