ENSDARG00000090740

Ensembl ID:
ENSDARG00000090740

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13512 Nonsense Available for shipment Available now
sa30828 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 149 306 2 2
Genomic Location:
Chromosome 3 (position 7415917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAAGGAGAAGCCTTATTCATGCTCTGTGTGTGGAAAGAGTTTCTCATA[T/A]CAAGGAAACTTAGGAAAACATCAGACKATTCACACTGGTGTGAGAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128960 Nonsense 190 306 2 2
Genomic Location:
Chromosome 3 (position 7415796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTTTCGTACGGCTGAAGACTTGAAAGTACATGAGAGGATTCACACT[G/T]GAGAGAGACCTTACAAGTGTTCACACTGCGACAAGAGATTTAATCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t6l0p5o1