mylka

Ensembl ID:
ENSDARG00000090738
ZFIN ID:
ZDB-GENE-030131-8207
Human Orthologues:
STK17A, STK17B
Human Descriptions:
serine/threonine kinase 17a [Source:HGNC Symbol;Acc:11395]
serine/threonine kinase 17b [Source:HGNC Symbol;Acc:11396]
Mouse Orthologue:
Stk17b
Mouse Description:
serine/threonine kinase 17b (apoptosis-inducing) Gene [Source:MGI Symbol;Acc:MGI:2138162]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124885 None None 243 None 5
ENSDART00000146782 Nonsense 473 674 8 9
Genomic Location:
Chromosome 9 (position 4110961)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCACTAAGAGCGTCTCMGAGGAAGAYCTGAAGGAGATCACGGCTGAG[C/T]AGATGGACTTCAGAGGGAACCTCCAACGGCAGATCAAGCCCAAGACTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vrm4u5b2