mylka

Ensembl ID:
ENSDARG00000090738
ZFIN ID:
ZDB-GENE-030131-8207
Human Orthologues:
STK17A, STK17B
Human Descriptions:
serine/threonine kinase 17a [Source:HGNC Symbol;Acc:11395]
serine/threonine kinase 17b [Source:HGNC Symbol;Acc:11396]
Mouse Orthologue:
Stk17b
Mouse Description:
serine/threonine kinase 17b (apoptosis-inducing) Gene [Source:MGI Symbol;Acc:MGI:2138162]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10145 Nonsense Available for shipment Available now
sa41343 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124885   None 243 None 5
ENSDART00000146782 Nonsense 473 674 8 9
Genomic Location (Zv9):
Chromosome 9 (position 4110961)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4106714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCACTAAGAGCGTCTCMGAGGAAGAYCTGAAGGAGATCACGGCTGAG[C/T]AGATGGACTTCAGAGGGAACCTCCAACGGCAGATCAAGCCCAAGACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124885 Essential Splice Site 121 243 3 5
ENSDART00000146782   None 674 None 9
Genomic Location (Zv9):
Chromosome 9 (position 4208537)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4142502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAACGATGCTGGGAGCTGCCAGGTTACTGTGGAGATCATTGTGGAAGG[T/C]AAAGCACACCTTGATTGGCTTAAGTTTAATATTATTAATCTACACAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link