NR_023326.1

Ensembl ID:
ENSDARG00000090725
Description:
wu:fj04e09 (wu:fj04e09), non-coding RNA [Source:RefSeq DNA;Acc:NR_023326]
Human Orthologue:
DYNC2H1
Human Description:
dynein, cytoplasmic 2, heavy chain 1 [Source:HGNC Symbol;Acc:2962]
Mouse Orthologue:
Dync2h1
Mouse Description:
dynein cytoplasmic 2 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:107736]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6400 Essential Splice Site Confirmed mutation in F2 line During 2017
sa10490 Nonsense Available for shipment Available now
sa39069 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35999 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6400
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127986 Essential Splice Site 1157 1667 29 41
Genomic Location (Zv9):
Chromosome 15 (position 43940976)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45123431
KASP Assay ID:
554-4637.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTAAAGAACCTGCACCTGGTCACAGCATGGCTCCCCCTGCKGGAGAAG[G/A]TGAGAACGCTCYGTCCGTCTGTCTGTCTCTGAAATGAAACAGATTTCTAG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
trunk
ZFA:0001115
posterior-most
BSPO:0000037
curved ventral
PATO:0001469
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa10490
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127986 Nonsense 1252 1667 32 41
Genomic Location (Zv9):
Chromosome 15 (position 43932433)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45131974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATGNNNNNNTGTTTATGTATTTTTCACAGGGTTGGACAAAGTTCTA[T/A]GAGTTTTCTCTGTCAGATCTGAGAGCYGGCTTCGAGATCATTGACCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127986 Essential Splice Site 1374 1667 35 41
Genomic Location (Zv9):
Chromosome 15 (position 43922694)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45141713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCGTTGCACAGTGAGAATATCTGTGTGTGTGTGTGTGTGTGTGTGCA[G/T]GTGATCTCTCAGCTGAGGATTCTGAGCAGGCCTGTCGCAGCAGGATCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127986 Nonsense 1666 1667 41 41
Genomic Location (Zv9):
Chromosome 15 (position 43896445)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45167962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGATCATGACACGTGGATCCAGAGCGGAGCGGCTCTCTTCCTCAAA[C/T]AGCAGTAACACAAACACACACACTTTATACTGACATTAGCATCACTTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link