ENSDARG00000090724

Ensembl ID:
ENSDARG00000090724
Human Orthologue:
SCN8A
Human Description:
sodium channel, voltage gated, type VIII, alpha subunit [Source:HGNC Symbol;Acc:10596]
Mouse Orthologue:
Scn8a
Mouse Description:
sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12084 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12084
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022382 Nonsense 91 746 3 17
ENSDART00000128198 Nonsense 189 397 5 9
Genomic Location:
Chromosome 2 (position 52588616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGTCTTCGCTCTGATCGGTCTGCAGCTCTTCATGGGGATCCTGAGA[C/T]MGAAGTGCGTCCGCAGCATCGGCCACTGCGTYAACTCCAYATACCCCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vvvdgn4r