prdm2a

Ensembl ID:
ENSDARG00000090721
ZFIN ID:
ZDB-GENE-081104-139
Description:
Novel zinc finger protein [Source:UniProtKB/TrEMBL;Acc:B0V2Z3]
Human Orthologue:
PRDM2
Human Description:
PR domain containing 2, with ZNF domain [Source:HGNC Symbol;Acc:9347]
Mouse Orthologue:
Prdm2
Mouse Description:
PR domain containing 2, with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:107628]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38695 Nonsense Mutation detected in F1 DNA During 2017
sa11381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38695
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127936 Nonsense 32 1064 1 3
ENSDART00000133440 Nonsense 155 1404 2 2
Genomic Location (Zv9):
Chromosome 8 (position 27713421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26841339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGCCACATACAAACACATGCTCTTTCAACATACCACACACAGCGGTTT[A/T]AATGCAGTCGATGCAGAAGGACCTTCAGTACATTGTTTAGTCGTCGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127936 Nonsense 81 1064 1 3
ENSDART00000133440 Nonsense 204 1404 2 2
Genomic Location (Zv9):
Chromosome 8 (position 27713569)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26841487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAMMGCTTGCACTGCTAATCAKAATATCYCTGGCAGAGGTGAGCCTT[T/A]GAAAACATCACTAAACCCAGAGCCAAAGAAATGCATTAATGCAGCTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link