xrcc6

Ensembl ID:
ENSDARG00000090718
ZFIN ID:
ZDB-GENE-030131-6420
Description:
Xrcc6 protein [Source:UniProtKB/TrEMBL;Acc:A8KC26]
Human Orthologue:
XRCC6
Human Description:
X-ray repair complementing defective repair in Chinese hamster cells 6 [Source:HGNC Symbol;Acc:4055]
Mouse Orthologue:
Xrcc6
Mouse Description:
X-ray repair complementing defective repair in Chinese hamster cells 6 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2487 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu2487
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124902 None None 408 None 9
ENSDART00000129869 Nonsense 503 610 10 12
ENSDART00000145276 Nonsense 503 610 10 12
Genomic Location:
Chromosome 12 (position 19999739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGGCTTTGGCTCTGGATATGCTTTCACCTGAACCCATTGAGGATT[T/A]GACAAGTATTTCTTGTTGTTTAAAGGGAAAAATTAGTATTTTTTTTATCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/phc4nnfq