cltcb

Ensembl ID:
ENSDARG00000090716
ZFIN ID:
ZDB-GENE-050227-12
Description:
clathrin, heavy polypeptide b (Hc) [Source:RefSeq peptide;Acc:NP_001181907]
Human Orthologue:
CLTC
Human Description:
clathrin, heavy chain (Hc) [Source:HGNC Symbol;Acc:2092]
Mouse Orthologue:
Cltc
Mouse Description:
clathrin, heavy polypeptide (Hc) Gene [Source:MGI Symbol;Acc:MGI:2388633]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22612 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11813 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123172 Essential Splice Site 1154 1683 22 33
ENSDART00000130989 Essential Splice Site 1149 1678 21 32
ENSDART00000134512 Essential Splice Site 1148 1677 21 32
ENSDART00000140249 None None 89 None 2
ENSDART00000143796 None None 318 None 8
Genomic Location:
Chromosome 15 (position 16337623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGACCCTTCAGCCTACATGGAAGTGGGACAAGCTGCAGCCCAAAGCGG[T/C]AAGAACCAGTCCCCTGATTCACGACTATATCCACAGCATCCAAAGGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123172 Nonsense 1424 1683 28 33
ENSDART00000130989 Nonsense 1419 1678 27 32
ENSDART00000134512 Nonsense 1418 1677 27 32
ENSDART00000140249 None None 89 None 2
ENSDART00000143796 Nonsense 52 318 2 8
Genomic Location:
Chromosome 15 (position 16342387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTGTATTACAGAGCCGTCCAGTTCTACCTGGAGTTCAAACCGCTGT[T/A]ACTGAATGACCTGCTGATCGTATTGTCTCCTCGTCTTGACCACACTCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nm1yad3f